Thursday Electronic Poster Session

Presented in the Regency Ballroom B,C,D
 
Thursday, October 11, 2012
 
2:40 – 3:30 pm
Listed in alphabetical order by First Author
 
Evaluation of Voice Recognition/Report Template Software in Increasing Efficiency in Hematopathology Report Turnaround Time
 
Samuel Barasch, MD (sbarasch@uwhealth.org),
Erik Ranheim, MD, PhD
 
Dept. of Pathology and Laboratory Medicine, University of Wisconsin, Madison, WI
 
Content:
Evaluation of the implementation of Voiceover software from Voicebrook company in regards to improving faculty, fellow, and resident efficiency.
The evaluation includes collected data on report turn around time as well as quantitative and qualitative evaluations.
 
Technology:
Voiceover (Voicebrook corporation, Lake Success, NY, USA) version 4.4.3. Dragon Medical (Nuance Communication Corporation, Burlington, MA, USA) version 10.10
 
Design:
Bone marrow aspirate specimen evaluation turn around is evaluated in March 2012 (one month prior to installation) and May 2012 (one month following installation).   A survey is submitted to residents, attendings, and the hemepath who use the software. 
 
Quantitative questions asked on the survey were as follows: 
 
Please rate from 1 (Strongly disagree) to 5 ( Strongly agree) the following statements:
-          I use the training / correction features of the software to improve voice recognition
-          Templates are helpful
-          I can get help when I have a question
-          Benefits of using the software outweigh the difficulties in learning and using the software
 
Qualitative questions asked on the survey were as follows:
 
-How has the software positively or negatively affected the workflow of reporting results
-How has the software positively or negatively affected your efficiency
 
Results:
Mean report turn around time improved from 2.5 days to 2.0 days. (p value 0.001, 95% CI difference in average TAT is 0.17 days – 0.70 days). Distribution of report turnaround time is also skewed to shorter times following software adaptation (please see Figure 1, histogram for March TAT, and Figure 2 histogram for May TAT).
 
 Figure 1.
 
 Figure 2.
 
Average scores for survey questions are as follows 1 (Strongly disagree) to 5 (Strongly agree)
 
-          I use the training / correction features of the software to improve voice recognition – 3.7
-          Templates are helpful - 5
-          I can get help when I have a question – 2.6
-          Benefits of using the software outweigh the difficulties in learning and using the software – 3.3
 
Qualitatively, most users commented that report turn around time has improved. Users also noted that the software and templates streamlined generation of a report on a straightforward case. Most users complained about having to type in or dictate CBC data within the marrow aspirate report.

Conclusion:
Improvement in reporting turn around time was evident soon after software implementation.  Because of unanimous consent regarding the usefulness of templates, it is important that a pathologist with appropriate academic and organizational authority be involved with template creation prior to a “go live” on this software. A “super-user” should be designated at the organizational level to coordinate usage and orient new users to templates. Despite an effective vendor training program, correcting errors in voice recognition has not yet been strongly employed by users; though some made qualitative comments about using this in the future. Comments about increased data entry on the part of the pathologist/ resident/fellow and concern for concomitant reporting errors are likely to be alleviated through increased integration with the clinical labs LIS.
 
 
Modeling Morphology in Adeno and Squamous Cell Carcinomas of the Lung
 
Hyun Ju Choi, PhD (hyunju.choi@emory.edu)1,
David A. Gutman, MD, PhD1,2, Madhusmita Behera, PhD3, Lee AD Cooper, PhD2, Gabriel Sica, MD, PhD3, Taofeek K. Owonikoko, MD, PhD3, Suresh S. Ramalingam, PhD3 , Fadlo R. Khuri, PhD3, Joel H. Saltz, MD, PhD1,2
 
1 Department of Biomedical Informatics, Emory
     University, Atlanta, GA
2 Center for Comprehensive Informatics, Emory
     University, Atlanta, GA
3 Department of Hematology and Medical Oncology,
     Emory University, Atlanta, GA

Content:
Lung cancer is the leading cause of cancer mortality in the United States. We have developed a computational pipeline to characterize cellular morphology in whole-slide images of lung tumor sections. In studies of glioblastoma, we have observed that morphological patterns are capable of predicting outcome and alterations in molecular cancer pathways (Cooper, JAMIA 2012). To demonstrate the descriptive power of the lung pipeline, we performed preliminary experiments to discriminate between squamous cell carcinomas and adenocarcinomas.
 
Technology:
To segment nuclei, color deconvolution was first applied to separate hematoxylin and eosin signals. Morphological reconstruction was then applied to the hematoxylin signal for denoising. Nuclei were identified in the reconstruction result by Ostu thresdholding, and clumped nuclei were separated using a watershed algorithm. Following segmentation, 54 features describing morphometry and texture were calculated for each nucleus. After stepwise feature selection, a support-vector-machine with Gaussian kernel embedding was investigated to distinguish histological subtypes.
           
Design:
Our study included 30 samples each of adenocarinoma and squamous cell carcinoma of the lung. Neoplastic regions were manually marked by a pathologist. Nuclei in these regions were segmented and the mean nuclear appearance was calculated for each slide. After feature selection, classifiers were trained and evaluated using leave-one-out cross-validation.
 
Results:
The overall classifier accuracy was 92.6%, 87.0% for adenocarcinoma and 98.2% for squamous cell carcinoma.
 
Conclusion:
Computational morphology is a promising area of research that has the potential to improve patient care. Our goal is to develop image-based approaches to recognize finer sub-classifications of tumors that will aid personalization of therapies, and to enable the discovery of morphological hallmarks of specific, predictive genomic alterations. Our preliminary results achieved high degree of accuracy in distinguishing adenocarcinoma and squamous cell carcinomas, suggesting that the extracted features express biologically meaningful information. Future studies will focus on investigating the linkage between tumor cell morphology, patient outcome, and genomics in larger data sets.
 
 
Impact of Internet Connectivity on International Telepathology Consultation Service
 
Ioan Cucoranu, MD (cucoranuic@upmc.edu)1, Park Seung, MD1, Anil V. Parwani, MD, PhD1, William Cable2, Jeff McHugh2, Liron Pantanowitz, MD1
 
1Department of Pathology University of Pittsburgh
      Medical Center, Pittsburgh, PA
2Information Services Division, University of
      Pittsburgh Medical Center, Pittsburgh, PA
 
Content:
Telepathology is an efficient way of distributing professional expertise over a broad geographic area. The use of telepathology tools has consequently allowed pathology consultation networks to be exploited to provide access to pathology subspecialty expertise in a cost-effective manner. Our institution developed a digital pathology consultation portal to receive digitized cases from local and international clients. The success of this telepathology service depends upon several factors, including the bandwidth of the telecommunications link between clients and consultants. Our goal was to evaluate the impact that Internet connectivity has on our teleconsultation practice.
 
Technology:
A custom developed web-based telepathology portal was used to remotely view digitized slides scanned with a Hamamatsu NanoZoomer 2.0-HT scanner (Bridgewater, New Jersey, USA) and stored on a server in Guangzhou, China. Speedtest.net was used for bandwidth evaluation.
 
Design:
Bandwidth tests for connections between 4 different workstation configurations (PC versus Mac; Ethernet versus WiFi; 10 Mbps versus 100 Mbps connectivity) at our institution, and various international (China and England), national and regional servers were performed. We also evaluated whole slide image loading times and turnaround time for digital teleconsultation cases signed-out during a 10 month period.
 
Results:
During this time period 59 consultation cases were signed out by subspecialty pathologists at UPMC. Average turnaround time was 3.71 days with 36 cases (61%) being signed out within 72 hours. User experience was satisfactory. Average image loading time was 7 seconds for digitized slides hosted on servers in China versus 2 seconds for slides stored on our local imaging servers. Bandwidth tests revealed significantly decreased download and upload speeds for connections to servers in China compared to those located locally (figure). Various computer configurations did not appear to alter image loading times or quality.

Conclusion:
This study shows that it is feasible to provide secondary subspecialty pathology teleconsultation for clients in China in a timely manner for various user workstation configurations using the Internet. Although image loading times for digital files stored in China were slightly longer, and network connection speeds to these remote servers in China was lower compared to that of local servers, this did not negatively impact our sign-out process.
 
 
QR Codes (2D Barcodes) in Anatomical Pathology Reports: Proof of Concept
 
Ioan Cucoranu, MD (cucoranuic@upmc.edu)1; Tony Piccoli2; Ralph Anderson2; Samuel A. Yousem, MD1; Liron Pantanowitz, MD1; Anil V. Parwani, MD, PhD1; Douglas J. Hartman, MD1
 
1Department of Pathology, University of Pittsburgh
     Medical Center, Pittsburgh, PA
2Information Services Division, University of
    Pittsburgh Medical Center, Pittsburgh, PA
 
Content:
Quick response (QR) codes are bar codes with two-dimension patterns that yield many possible combinations. While traditional bar codes can store 20 digits, QR codes can store up to 7089 digits or 4296 alphanumeric characters. Scanning QR codes with mobile devices such as smartphones with built-in digital cameras facilitates quick reference to online content and even small automation tasks such as dialing phone numbers or sending text messages. In medicine, the use of QR codes to date has had limited use. For example, clinicians are using QR codes to help patients manage their conditions, keep their appointments, or for quick access to a patients’ medical records. However, to the best of our knowledge QR codes have not been used in pathology. The aim of this study was to demonstrate that QR codes could be used successfully in surgical pathology reports to direct patients and/or their healthcare providers to appropriate supportive resources.
 
Technology:
Cerner CoPath v.3.2 with PICSPlus (Cerner Corporation, Kansas City, Missouri, USA), and online QR code generator: http://qrcode.kaywa.com (Kaywa, San Francisco, California, USA)
 
Design:
QR codes, storing uniform resource locators for websites with useful information for patients were generated as PNG files and introduced into Copath PICSPlus as JPEG image files. This allows for the appropriate QR code images to be embedded into the synoptic report field of the pathology report as JPG 2000 files (approximately 1.50 kilobytes). For this proof of concept, we utilized uniform resource locators for our institutions cancer center organ specific cancer webpages.
 
Results:
It is technically possible to embed QR codes into anatomical pathology reports designed to direct readers of these reports to the appropriate cancer center at our institution (figure).
 
 
Conclusion:
Embedding QR codes into surgical pathology reports is technically feasible and a novel means of providing patients and their providers with a value-added surgical pathology report with direction to clinical care specialists. QR codes can store more information than traditional barcodes and can be easily scanned at high speed in any direction or orientation with mobile devices. Hardlinking with QR codes in paper reports could be replaced by hyperlinks in electronic reports. While this low cost technology is easy to implement and use, ongoing maintenance of a QR code library is necessary to ensure that the referred content remains current. The added value of incorporating QR codes into pathology reports is not just for assisting with continuity of care, and contributing to the meaningful use of electronic medical record, but also related to the fact that they are a useful tool for marketing and patient education.
 
A Pattern Recognition System for Identifying Cancer Cells in Serous Effusions
 
David Friedrich (David.Friedrich@LfB.RWTH-Aachen.de)1, Chen Jin, PhD2, Yu Zhang, Dipl.-Inf.1, Chen Demin2, Li Yuan2, Leonid Berynskyy, PhD3, Stefan Biesterfeld, MD3, Dietrich Meyer-Ebrecht1, Alfred Boecking, MD3
 
1Institute of Imaging and Computer Vision , RWTH
    Aachen University, Aachen, Nordrhein Westfalen,
    Germany
2Motic China Group Co. Ltd., Torch Hi-Tech Industrial
    Development Zone, Xiamen, Peoples Republic of
    China
3Department of Pathology, Division Cytopathology,
    H.-H.-University D¨usseldorf, Germany
 
Content:
About 45% of body cavity effusions are caused by metastasizing cancers. For diagnostic assessment, effusion fluid is acquired by aspiration and investigated cytologically. One such cytological technique is DNA Image Cytometry (DNA-ICM), where the diagnosis is based on the DNA distribution measured on morphologically suspicious nuclei. Its diagnostic performance is superior to the conventional interpretation of the cell morphology (Sensitivity 76% vs. 56%, specificity 100% vs. 97.5%). However, more than 40 minutes are required for a manual DNA-measurement and skilled personnel is often missing. Therefore, the use of DNA-ICM has been limited to a few specialized institutions.
 
Technology:
In order to make this technique available to a wider range of patients, a concept for performing DNA-ICM on effusions more efficiently is presented. A pattern recognition system has been built up, using features describing nuclear morphology, a Random Forest classifier and a gold standard database (48.777 Feulgen-stained nuclei from seven effusions). In combination with a motorized microscope and an autofocus system (Motic BA610), this system is used to automatically collect and pre-classify nuclei into six classes (artifacts, suspicious cells, granulocytes, lymphocytes, macrophages, mesothelial cells). Subsequently, the pathologist verifies the classification in the diagnostically relevant classes and DNA ranges.
 
Design:
The pattern recognition system was evaluated and optimized using the leaving-one-out strategy. Subsequently, the system was applied on a test set from ten patients with the workflow described above and compared to the corresponding manual DNA-ICM results.
 
Results:
The pattern recognition system achieved an overall correct classification rate of 87%. More importantly, 92% of all morphologically suspicious cells were correctly identified. The achieved classification rate plus the final verification of the diagnostically relevant objects were sufficient to confirm the previous diagnosis in all cases from the test set. Interaction time of the pathological expert was reduced from 40 to five minutes per case.
 
Conclusions:
The presented system successfully identified morphologically suspicious cells among thousands of other nuclei and artifacts. Applied in a workflow which requires little interaction by experts, the DNA-ICM diagnoses from the reference measurements could be confirmed in all cases, whereas the productivity was increased by a factor of eight.
 
 
The Construction of an Open Source
Whole Slide Imaging Library for Graduate
Pathology Education
 
Christopher A. Garcia, MD (chris.garcia@utah.edu), Mohamed E. Salama, MD
 
Department of Pathology, University of Utah, Salt Lake City, UT
 
Content:
Virtual microscopy and online Whole slide image (WSI) libraries are becoming common and have been shown to be a useful educational resource. There are many options and resources currently available for constructing a WSI library. Due to the amount of available resources, it is important to recognize and prioritize what factors are most important to the users. This will help to dictate what technologies and designs will be employed to achieve the desired end product. The goal in constructing our site was to build a site that would maximize accessibility, editing of content, collaboration, ease of use, and flexibility of organization.
 
Technology:
The University of Utah Digital Pathology Project is a web application that is a modified version of New York University School of Medicine's Virtual Microscope (NYU VM) application (cloud.med.nyu.edu/virtualmicroscope). The viewer is built on the Google Maps Javascript Application Programming Interface (API, Google Inc., Mountain View California). This required a program that would convert commercially available WSI files to jpeg and a compiler to present the files in Google Maps format (written in Python, NYU VM). The site is built on the Django web framework (www.djangoproject.com), which is an open-source project written with Python (www.python.org) programming language. HTML 5, HTML, CSS, and JavaScript (jQuery) was used for client side scripting.
 
Design:
The core application development was completed in the available release of the NYU VM (Beta 5). Modifications to the WSI installer script, metadata framework, and graphical presentation were made in order to customize the application to our workflow, and our educational needs. Some functionality (testing, modes of navigation) was taken out of the current build until it could meet expectations. The user interface was modified to be more navigable by tablets, to be more attractive, and to meet university identity standards. WSI scanning was modified to remove all identifiable information. Standard operating procedures were put in place for scanning, selection of material, uploading files, and editing of files. Instructional videos were created for the use and modification of the site.
 
Results:
The homepage displays a brief introduction and allows the user to immediately view a random case or to search by study set, organ system, or any word in the slide metadata. Each WSI represents a case that can be modified with the addition of images (gross photos, any .jpg or .png) or metadata (which includes descriptive markers, case history, diagnosis, diagnostic description and more). The organization of the site is dynamic, with no coding needed to assign a WSI to a different or additional study set. Additionally, no coding is necessary to add or edit metadata for a slide. The WSI set is growing, but currently contains 300 slides. The site can be accessed at imageserver.path.utah.edu. The site fully functions on any browser that supports HTML 5, and is optimized for tablet use. Anyone can view the slides, but you must log in and have appropriate permissions to edit or add cases. The application source code will be made available under the open source MIT License.
 
Conclusion:
This online WSI library application was built with open source software and was modified to meet the goals and requirements of our department. It is possible that departments with similar or less information technology resources can adopt and appropriate the same software to meet their needs.
 
  
Introduction of a Novel Multivariate Delta Check Approach to Identify Specimen I
Inaccuracies
 
Thomas Kampfrath, PhD(t0kamp01@louisville.edu), James J. Miller, PhD

Pathology and Laboratory Medicine, University of Louisville, Louisville, KY

Content:
Inaccuracies in specimens of patients may lead to misdiagnosis and inappropriate therapy. The primary purpose of a delta check is to detect misidentified specimens. The traditional delta check procedure compares the change in concentration of an analyte with a delta check limit (DCL) for that analyte. A change greater than the DCL sets a delta check flag for that analyte. This procedure is typically applied to several analytes on a panel. One or more flagged analytes on the panel suggests the possibility that one of the two specimens was misidentified. This procedure is called Univariate (Multianalyte) Delta Check (UDC) and generates many FP flags. Any improvement would be desirable. Here, we hypothesized that a Multivariate Delta Check (MDC) procedure would produce fewer false positive flags than the traditional method.
 
Results:
A panel of results on a sample can be graphed as a point in space with one axis for each analyte. A subsequent panel of results can be graphed as a second point in space. If 8 analytes are included, there would be 8 axes in 8-space indicated as MDC8; with 5 analytes MDC5 , respectively. The Multivariate Delta (MD), the distance between these two points, is given by: 
 
MD = SQRT(((analyte12-analyte11)2/(SD RR1)) + ((analyte22-analyte21)2/(SD RR2)))
 
The subscript 1 and 2 refer to the results on the first and second sample and the divisor refers to the standard deviation of the reference range respectively.
We calculated the MD for 1035 pairs of patient results from our laboratory on a Basic Metabolic Panel (BMP; Na+, K+, Cl-, CO2, glucose, BUN, creatinine, Ca2+) and for 1034 pairs of intentionally misidentified BMP results. Afterwards, we calculated the sensitivity and specificity at various MD values and constructed Receiver-Operating Characteristic (ROC) curves. The UDC5 is currently used by our hospital laboratory and includes the following 5 analytes (DCL): BUN (10 mg/dL); Ca2+ (1.5 mg/dL); Creatinine (1.5 mg/dL); K+ (1.2 mmol/L); and Na+ (8 mmol/L). Here, we compare the sensitivity of the MDC8, MDC7 (minus glucose) and MDC5 (same analytes as current UDC5) at the specificity of the UDC5 (0.862).
 
Results: The sensitivity and specificity of UDC5 is 0.573 and 0.862, respectively. Areas under the ROC curve for MDC8, MDC7 and MDC5 are 0.823, 0.855, and 0.843, respectively. The sensitivities of UDC5, MDC8, MDC7 and MDC5 at a specificity of 0.862 are: 0.573, 0.545, 0.671, and 0.656, respectively. This novel method can be extended to an unlimited number of analytes. Thus, at the specificity of UDC5, the sensitivity of MDC8 was not as high, but the sensitivity of MDC 7 and MDC5 were higher.
 
Conclusion: The MDC7 (BMP without glucose) procedure had the highest area under the ROC curve and higher sensitivity at the specificity of the current UDC5 procedure. The MDC method is more efficient than the UDC method used in our laboratory, which results in more true positive flags and fewer false positive flags.
 
 
Role of Transcription Factor Th-POK as CD8 Transcriptional Repressor in CD4+ CD8+ Thymocytes Committed to the CD4 T Cell Lineage
 
Rahul G. Matnani, MBBS, PhD (rgmatn2@uky.edu)
 
Content:
Developing double positive (DP) CD4+CD8+ T cells differentiate in thymus and either adopt the single positive (SP) CD4+ helper T cell or CD8+ cytotoxic T cell phenotype. Th-POK ( T helper inducing POZ/ Kruppel like factor) or also called cKrox is expressed specifically in thymocytes committed to CD4 T cell lineage. Helper deficient (HD) mice have a point mutation in Th-POK protein and lack CD4 T cells in periphery. Th-POK expression has been found to be necessary to induce gene expression program for CD4 T cell lineage and inhibit CD8 gene expression program.Th-POK protein has an amino terminal BTB/POZ domain and four C2H2 type zinc finger domains. The amino-terminal BTB/POZ domain is known to interact with chromatin remodeling factors to mediate transcriptional repression. Th-POK protein is also known to bind to the promoter of Col1a gene in the skin to mediate transcriptional repression. This suggests that Th-POK is likely to play the role of a transcriptional repressor during the process of commitment of DP thymocyte to CD4 T cell lineage.
 
Technology:
E8III enhancer region in the CD8 gene is a DP thymocyte specific enhancer. Using Vector NTI software, known Th-POK consensus binding sequences ( 5’- GGGAGGG-3’, 5’- GGAGGG-3’ ) were identified in the E8III genomic sequence. The sequence for E8III enhancer region is from MGI database ID- 88347 for Cd8b gene.
 
Design:
To prove in vitro binding, double-stranded synthesized and 32P end-labeled oligonucleotides from Cd8 loci, which have the Th-POK binding motif will be initially utilized as probes for EMSA analysis. To prove in vivo binding, chromatin immunoprecipitation (ChIP) analysis will be performed to confirm binding of Th-POK to the enhancer regions.
 
Results:
Using VECTOR NTI software, nine potential Th-POK binding sites were identified in 4.1 kb EcoRI/BamHI E8III enhancer region. Three representative sense strand sequence of oligonucleotides are shown below with translational start site (+1) shown in parentheses. The bold sequences represent the Th-POK binding motifs and the underlined sequences represent motif on the complementary strand.
1) 5’ TCCTTTCCTCCCTCCCCACTTCTC 3’ (+6985 to +7008 b.p.)
2)5’ATTCACTTCCTCCCTCATGTGTGGAGGGCTTTCTAG 3’(+7844to +7879b.p.)
3) 5’TGACTAAAGGGGGGGGGGGTGCATTTG 3’ (+8424 to +8450 b.p.)
 
Conclusion:
The experiments proposed in this study will help to determine the role of Th-POK in silencing of CD8 loci in positively selected DP thymocytes committed to CD4 T cell lineage. This can result in therapies directed to increase CD4 T cell count in HIV and in other immunocompromised patients.
 
 
Analysis of Whole Slide Imaging
(WSI) Scan Failures
 
Tushar N. Patel, MD (tushar_patel@rush.edu)1, Seung Park, MD2, Jon Duboy2, Anil V. Parwani, MD, PhD2, Walid E. Khalbuss, MD2, Liron Pantanowitz, MD2
 
1Department of Pathology,Rush University, Chicago,IL
2Department of Pathology, University of Pittsburgh
     Medical Center, Pittsburgh, PA

Content:
Digitizing glass slides using whole slide imaging (WSI) scanners involves slide preparation and rapid, automated image acquisition aimed at generating an accurate digital representation of the original glass slide. The aim of this study was to evaluate the frequency and reasons for WSI scan failures at an academic institution.
 
Technology:
Aperio ScanScope XT 120 WSI scanner and HP xw4600 computer workstation (2.66GHz Intel Core 2 Quad Q9400, 4GB RAM).
 
Design: 
During a 7 month period 4,262 glass slides were digitized using a WSI scanner for various reasons (archiving, quality assurance, education, research). Prior to scanning slides were cleaned and correctness of cover-slipping ensured. Double-thick previously repaired slides were excluded. All slides that failed scanning during this period were recorded as WSI failures. Slides that failed initial automatic scanning were manually re-examined at high magnification, directed focus selection performed and image re-acquisition attempted.
 
Results:
A total of 19 slides (0.45%) were considered WSI failures. Thirteen (68%) of these failures were non-gynecological cytology specimens, all of which had insufficient tissue (too little or pale) to permit autofocusing by the WSI scanner. Attempts to manually rescan these slides were unsuccessful due to insufficient focus points and image stitch mismatching. Five (26%) glass slides of a neuropathology case from 1960 were too thick to be scanned. One slide (5%) was received irreparably broken and did not scan. Technical issues and user error did not result in any WSI failures.
 
Conclusions:
WSI scanning technology continues to mature. Nonetheless, as these data show, a small percentage of glass slides may fail to scan, despite proper glass slide preparation prior to image acquisition. Insufficient tissue, non-standard or broken glass slides may contribute to WSI failures. Such WSI failures need to be taken into consideration when adopting digital pathology. Further research is needed to identify technological and workflow solutions to minimize WSI scan failures, as well as improve tissue detection and autofocusing capabilities of WSI scanners.
 
Implementation of an Enterprise-wide Picture Archiving and Communication System (PACS) for Henry Ford Health System (HFHS) Department of Pathology and Laboratory Medicine (PALM)
 
Robert Stapp, DO (rstapp1@hfhs.org), Mehrvash Haghighi, MD, Tina Caruana, Ron Brown, J. Mark Tuthill, MD
 
Department of Pathology, Henry Ford Hospital, Detroit, MI
 
Content:
We implemented an enterprise PACS throughout the laboratories of HFHS. PACS was deployed across HFHS-PALM that includes four hospitals. A database server was deployed in our data center with client software installed on workstations for pathologists, grossing, and autopsies.
 
Technology:
The software (Apollo EPMM® v9.4.3, Falls Church, VA, USA) is a file agnostic image database responsible for managing a variety of image acquisition devices based upon the Microsoft .NET® framework and allows secure storage and distribution of digital files acquired from slides, gross specimens, X-rays, whole-slide imaging, electron microscopy, as well as document scanners. EPMM is capable of interfacing with information systems through its use of HL7, DICOM, and ADT interfaces. Database images can be accessed though the use of the client software or via a web-portal interface.
 
Design:
Staff were directed to acquire images in real-time during the grossing and sign-out process as well as ad hoc additions to cases. Legacy data was converted from our previous archive, requiring importing demographic information of 290,000 cases into the database. This was accomplished by extracting data from our anatomic pathology laboratory information system (LIS); the achieved files, approximately 512,000, were then matched and imported based upon case accession number. In the current live implementation of PACS, demographics are obtained through an ADT interface with our LIS.
 
Results:
Prior to the PACS, all files were hosted on a shared server based on a traditional file-folder hierarchy using accession number as the root for cases. This system became increasingly inefficient due to the volume of cases and resultant slow access time, limited controls to associate the correct image data to the correct patient, and lack of user and role based security. PACS provided improvements in speed, efficiency, and security. Inter hospital consultations are now performed in real-time. PACS is used to acquire all scanned requisitions and gross images through using automated file mover services. Tumor board presentations have become more efficient and accessible.
 
Conclusions:
PACS system has shown growth in both usage and implementation with increases in efficiency, patient safety, security, and accessibility. As additional features are implemented, PACS will prove to be an invaluable for pathologists.
 
 
HPath: A Browser-Based, User-Extensible Report Generator for Clinical Environments
 
Sean R. Wilkinson BA (wilkinson@uab.edu), Jonas S. Almeida PhD, James R. Hackney MD, Benjamin C. Hill MD
 
Department of Pathology, University of Alabama at Birmingham, Birmingham, AL
 
Content:
This presentation describes HPath, a user-extensible tool for generating text reports from templates, and provides an example for creating hematopathology reports, which typically follow a well-structured format suitable for automatic generation. HPath allows domain experts to quickly generate text reports using interactive form elements within a web browser. The generated text can be edited within the tool if necessary and then copied and pasted into the hospital Laboratory Information System (LIS). The data layer is completely decoupled from the presentation layer: a template system enables clinicians to adapt the tool to their own needs by defining and/or loading other templates. Using HPath requires no installation or special software, and extending it requires minimal programming knowledge.
 
Technology:
HPath runs entirely in the "sandbox" environment of an ordinary web browser: the text report generated does not leave the user's machine and the application does not have programmatic access to the machine's filesystem.
 
Design:
HPath's template specifies an interactive form for composing a formatted report using only a mouse- or touch-based interface and provides instant visual feedback by re-generating and displaying output dynamically. A template is any HTTP-accessible plain-text document whose contents conform to HPath's domain-specific language (DSL), which is based on the human-readable JavaScript Object Notation (JSON) format.
 
Results:
The source code is made publicly available, with version control and documentation, at https://github.com/wilkinson/hpath. As detailed in the documentation, the default hematopathology template, loaded by appending "?https://raw.github.com/wilkinson/hpath/templates/default.js", can be replaced or extended by additional user-defined modules.
 
Conclusion:
HPath can streamline workflows in hospital environments for which the LIS interface is difficult or impossible to modify, and it can generate a wide variety of reports such as the hematopathology example included as the default template. This report generation tool illustrates uses of Web technologies for easier application development and maintenance and allows for collaborative configuration by domain experts.
 
 
An Intelligent Spreadsheet to Aid in Bone Marrow Engraftment Analysis
 
Christopher Williams, MD
(christopher-williams@ouhsc.edu), S. Terence Dunn, PhD, Richard A. Allen, BS, MB (ASCP)
 
Department of Pathology, University of Oklahoma Health Sciences Center, Oklahoma City, OK 
 
Content:
Short tandem repeat (STR) analysis, performed for bone marrow engraftment evaluation, is tedious and time-consuming, requiring relatively complex, manual calculations. [glb1] While these calculations are repetitive, choosing appropriate equations for analysis of data is context-dependent, necessitating some element of decision-making. In addition, noise from aberrant amplification of STR loci needs to be taken into account. The intent of this application is to automate repetitive calculations while using the technologist’s expertise to ensure accurate results.
 
Technology:
A prototype of the application was initially developed using LabView (National Instruments; Austin, TX). The prototype was used as a proof-of-concept and a guide for the final architecture. The three main considerations for the final development environment were cost, ease of distribution[T2] , and usability. Despite certain drawbacks, Microsoft (Redmond, WA) Excel with Visual Basic for Applications best fulfilled these criteria since it is already licensed and installed on every computer at our institution and end users are familiar with the program.
 
Design:
Plain text data files formatted as comma separated lists (.csv) are imported directly from an Applied Biosystems (Carlsbad, CA) capillary electrophoresis instrument as spreadsheets, one file each for the recipient (pre-transplant), the donor, and post-transplant samples. Visual Basic subroutines scan these spreadsheets, identifying overlapping peaks (amplified products from STR analysis) between the post-transplant and donor/recipient samples. Rather than simply returning a result, the subroutine returns the chosen formula and resulting calculation to facilitate review and manipulation as needed.
 
Results:
Running historical data through the application produced highly concordant results with manual calculations and required minimal manipulation from the reviewer. The time required to run the application and review the results is considerably less than performing manual calculations (several minutes [glb3] vs. 30-60 minutes). Our molecular laboratory has performed a comprehensive validation of the application and has recently deployed it as part of the STR analysis of clinical samples.
 
Conclusions:
 
 
Ensuring Appropriate Reporting of Urgent, Significant, and Unexpected Anatomic Pathology Diagnoses to Patients
Using Electronic Transmission of HL7 Flags
to the EHR
 
Joseph A. Zeitouni, MD (jzeitouni@med.miami.edu), Philip Chen, MD, PhD
 
Department of Pathology, University of Miami Miller School of Medicine, Miami, FL
 
Content:
The reporting of urgent, significant, and unexpected diagnoses in anatomic pathology as a patient safety issue has been the subject of a recent consensus statement by the College of American Pathologists and the Association of Directors of Anatomic and Surgical Pathology. With widespread adoption of EHR in clinical practices, well-designed communications between AP LIS and EHR offer opportunities for pathologists not only able to report these significant findings to treating physicians, but also to ensure appropriate patient management is rendered.
 
Technology:
Copath 6.0 (Sunquest Information Systems, Tucson, Arizona), Epic IU 5 (Epic Systems Corporation, Verona, Wisconsin)
 
Design:
At the time of electronic signout in the AP LIS, the pathologist will be presented with a pop-up window with a prompt to flag the case as containing an urgent, significant or unexpected finding. A web link to a reference of current medical executive committee approved criteria for case flagging will be available. If the pathologist flags the case, a data collection window will appear to allow documentation of the discussion with the physician. Additionally, a flag will be released as part of the HL7 result to the EHR, where an ”Urgent/Significant diagnosis encounter" will be opened. The encounter in the EHR must be closed by the responsible physician within 48 hours by electronically signing an attestation that the patient was told of his/her diagnosis. Aging encounter reports generated in the EHR will be monitored daily and subjected to an escalation policy to ensure that physician manage the patients in a timely fashion
 
Results:
Conclusions:
There is a growing recognition that if pathologists are to continue to be regarded as members of the clinical management team, they must assume responsibilities of ensuring that patients are managed appropriately based on the findings from diagnostic tests or procedures. Pathologists should not be afraid to leverage the EHR to develop systems that improve patient care. By doing so, they extend their influence beyond the four walls of the laboratory, and can reestablish themselves as being physicians at the center of patient care.
 

 

Copyright 2009 | Site by UMC Web Team